ID: 977148693_977148704

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 977148693 977148704
Species Human (GRCh38) Human (GRCh38)
Location 4:93480890-93480912 4:93480941-93480963
Sequence CCCACCTCCCTGAATCTCTACAG TTTCAAATTTCATGCATTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 226} {0: 1, 1: 0, 2: 5, 3: 70, 4: 701}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!