ID: 977167829_977167833

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 977167829 977167833
Species Human (GRCh38) Human (GRCh38)
Location 4:93723438-93723460 4:93723479-93723501
Sequence CCAGACCAGGAGATTAGGGTATG TTAGCTACACACAACCAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!