ID: 977183004_977183005

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 977183004 977183005
Species Human (GRCh38) Human (GRCh38)
Location 4:93900891-93900913 4:93900904-93900926
Sequence CCAGTTTTTGCTCATAAGTCATG ATAAGTCATGTAAGCTGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 177} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!