ID: 977218595_977218600

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 977218595 977218600
Species Human (GRCh38) Human (GRCh38)
Location 4:94312750-94312772 4:94312791-94312813
Sequence CCCATTATTGTATGGGAATCTCA AAGGACTTGGTTTATGAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 181} {0: 1, 1: 35, 2: 3094, 3: 6493, 4: 2773}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!