ID: 977275676_977275677

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 977275676 977275677
Species Human (GRCh38) Human (GRCh38)
Location 4:94975032-94975054 4:94975054-94975076
Sequence CCAACAGACTTCACAAGGACGAA AACTTCCAGTTTGTTATTTACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 102} {0: 1, 1: 0, 2: 3, 3: 24, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!