ID: 977303774_977303777

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 977303774 977303777
Species Human (GRCh38) Human (GRCh38)
Location 4:95298366-95298388 4:95298385-95298407
Sequence CCCTATGCCAACTGCACACACTG ACTGCTCCCATCTTTAGCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!