ID: 977313386_977313393

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 977313386 977313393
Species Human (GRCh38) Human (GRCh38)
Location 4:95414219-95414241 4:95414271-95414293
Sequence CCCCCACAAAAAATAGGTCTGGT ATAAGAAAAAAGAAGATGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 145} {0: 1, 1: 0, 2: 15, 3: 304, 4: 3060}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!