ID: 977369335_977369341

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 977369335 977369341
Species Human (GRCh38) Human (GRCh38)
Location 4:96115316-96115338 4:96115358-96115380
Sequence CCATTCACTGTCAGGTGAACAGC ATAATTCAGTCATCTCCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 37, 3: 287, 4: 515} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!