ID: 977444264_977444267

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 977444264 977444267
Species Human (GRCh38) Human (GRCh38)
Location 4:97109551-97109573 4:97109565-97109587
Sequence CCCAGATTATAAAATTGTAGAAG TTGTAGAAGAATATGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 310} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!