ID: 977466896_977466903

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 977466896 977466903
Species Human (GRCh38) Human (GRCh38)
Location 4:97393772-97393794 4:97393804-97393826
Sequence CCTCCGCCTCCTGGATTCACGTG CCTCAGCCTCCTGAGTAGCTGGG
Strand - +
Off-target summary {0: 2, 1: 457, 2: 9102, 3: 41244, 4: 92152} {0: 96881, 1: 202886, 2: 238913, 3: 154169, 4: 85070}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!