ID: 977466898_977466907

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 977466898 977466907
Species Human (GRCh38) Human (GRCh38)
Location 4:97393778-97393800 4:97393831-97393853
Sequence CCTCCTGGATTCACGTGATTCTC TAGGCTCCTGCCATCACACCTGG
Strand - +
Off-target summary {0: 4, 1: 1541, 2: 27797, 3: 85860, 4: 172531} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!