|
Left Crispr |
Right Crispr |
Crispr ID |
977471347 |
977471355 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:97447506-97447528
|
4:97447558-97447580
|
Sequence |
CCACTGCTCTGTGCAGCCTCAGT |
GCTCCAGCCTTGGCTAAAACGGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 74, 2: 176, 3: 401, 4: 1194} |
{0: 1, 1: 20, 2: 352, 3: 1047, 4: 1814} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|