ID: 977471347_977471355

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 977471347 977471355
Species Human (GRCh38) Human (GRCh38)
Location 4:97447506-97447528 4:97447558-97447580
Sequence CCACTGCTCTGTGCAGCCTCAGT GCTCCAGCCTTGGCTAAAACGGG
Strand - +
Off-target summary {0: 2, 1: 74, 2: 176, 3: 401, 4: 1194} {0: 1, 1: 20, 2: 352, 3: 1047, 4: 1814}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!