ID: 977477977_977477986

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 977477977 977477986
Species Human (GRCh38) Human (GRCh38)
Location 4:97537426-97537448 4:97537473-97537495
Sequence CCCTCAGAGCCTCCCTTGTTGCT GCAAGGCAGCAGCAAGGCTGGGG
Strand - +
Off-target summary No data {0: 147, 1: 745, 2: 2011, 3: 1909, 4: 1455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!