ID: 977517862_977517866

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 977517862 977517866
Species Human (GRCh38) Human (GRCh38)
Location 4:98044923-98044945 4:98044958-98044980
Sequence CCATAAGCATTCCTTTTATTCTC GGTCTGCCTCACCATGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 440} {0: 1, 1: 0, 2: 0, 3: 14, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!