ID: 977522267_977522268

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 977522267 977522268
Species Human (GRCh38) Human (GRCh38)
Location 4:98099867-98099889 4:98099881-98099903
Sequence CCTGTACATTTTAAAATAACTAC AATAACTACAAGAGTATAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 371} {0: 8, 1: 424, 2: 977, 3: 1228, 4: 2944}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!