ID: 977536785_977536788

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 977536785 977536788
Species Human (GRCh38) Human (GRCh38)
Location 4:98262601-98262623 4:98262626-98262648
Sequence CCACTCCTGTCTGTCATAATTTC CTTTTTAAAATTTGCTCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 254} {0: 1, 1: 0, 2: 4, 3: 45, 4: 455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!