ID: 977537404_977537409

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 977537404 977537409
Species Human (GRCh38) Human (GRCh38)
Location 4:98270820-98270842 4:98270839-98270861
Sequence CCCCTCCTCTTCTCAGCCTACTC ACTCAAGAGTGACTATAATAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 66, 4: 702} {0: 1, 1: 0, 2: 0, 3: 12, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!