ID: 977574074_977574090

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 977574074 977574090
Species Human (GRCh38) Human (GRCh38)
Location 4:98658701-98658723 4:98658739-98658761
Sequence CCGCCCGCAGCTCCGCCCGCCGC GCGCGCGCGCGCACGGGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 88, 4: 757} {0: 1, 1: 0, 2: 4, 3: 24, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!