ID: 977574076_977574090

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 977574076 977574090
Species Human (GRCh38) Human (GRCh38)
Location 4:98658705-98658727 4:98658739-98658761
Sequence CCGCAGCTCCGCCCGCCGCCCAA GCGCGCGCGCGCACGGGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 329} {0: 1, 1: 0, 2: 4, 3: 24, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!