ID: 977607521_977607522

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 977607521 977607522
Species Human (GRCh38) Human (GRCh38)
Location 4:98996804-98996826 4:98996828-98996850
Sequence CCAGGTTTAGTGAAGAGAGGCAC TGAATATTCAAATATTAAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99} {0: 1, 1: 1, 2: 7, 3: 90, 4: 961}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!