ID: 977609515_977609519

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 977609515 977609519
Species Human (GRCh38) Human (GRCh38)
Location 4:99017759-99017781 4:99017793-99017815
Sequence CCAAAGGTAATCTTTCTGCTTTC TGGCATTGGCTGCCACAGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 56, 4: 403} {0: 1, 1: 0, 2: 1, 3: 22, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!