ID: 977634368_977634379

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 977634368 977634379
Species Human (GRCh38) Human (GRCh38)
Location 4:99280143-99280165 4:99280190-99280212
Sequence CCACCAAGAATAGCTCCCTTCCA AGGGTTCATTGAGAGGTTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 162} {0: 1, 1: 0, 2: 3, 3: 12, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!