ID: 977693953_977693960

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 977693953 977693960
Species Human (GRCh38) Human (GRCh38)
Location 4:99946830-99946852 4:99946864-99946886
Sequence CCGGGGCGTCCGAGCTGACTCGG CGGCGCCAGCAGGCTCGAAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 103} {0: 1, 1: 0, 2: 1, 3: 3, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!