ID: 977723724_977723733

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 977723724 977723733
Species Human (GRCh38) Human (GRCh38)
Location 4:100270188-100270210 4:100270232-100270254
Sequence CCTGTCTCAGCCTCCCAGAGTGC CCGTACCTGGCCTTGTGTTTTGG
Strand - +
Off-target summary {0: 94, 1: 5019, 2: 76608, 3: 195204, 4: 244166} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!