ID: 977736593_977736598

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 977736593 977736598
Species Human (GRCh38) Human (GRCh38)
Location 4:100424530-100424552 4:100424557-100424579
Sequence CCCACATCCCAGCACGCACTGCA CATGCATTTTTGACATCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 207} {0: 1, 1: 0, 2: 1, 3: 18, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!