ID: 977772101_977772103

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 977772101 977772103
Species Human (GRCh38) Human (GRCh38)
Location 4:100871504-100871526 4:100871523-100871545
Sequence CCCTCAGACTTCTACTGGCAGAA AGAAAGCTGCAATAGCCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 176} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!