ID: 977777222_977777225

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 977777222 977777225
Species Human (GRCh38) Human (GRCh38)
Location 4:100935415-100935437 4:100935430-100935452
Sequence CCTTTACCTAAGTCTCTGAGAGT CTGAGAGTATGTAAGGCCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!