ID: 977786240_977786246 |
View in Genome Browser |
Spacer: 20 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 977786240 | 977786246 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 4:101038049-101038071 | 4:101038092-101038114 |
Sequence | CCACAACCTTGCAAGCTTCCTGT | CATAACATGGGGCATGAACCTGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 0, 3: 3, 4: 117} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |