ID: 977799538_977799547

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 977799538 977799547
Species Human (GRCh38) Human (GRCh38)
Location 4:101210199-101210221 4:101210247-101210269
Sequence CCAGACTATTTCTCCAAGTTCCC GATCCTCAAACTCTATGGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 264} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!