ID: 977809834_977809847

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 977809834 977809847
Species Human (GRCh38) Human (GRCh38)
Location 4:101346526-101346548 4:101346554-101346576
Sequence CCAAGTGAGGCTGGGTGGGACGC GGAAGGGCGCCGCGGGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 159} {0: 1, 1: 0, 2: 2, 3: 65, 4: 611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!