ID: 977847095_977847096

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 977847095 977847096
Species Human (GRCh38) Human (GRCh38)
Location 4:101779224-101779246 4:101779251-101779273
Sequence CCAAGAACTGTTTCTCAAAAAGA AGCAATCTGCAGATGATGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!