ID: 977848216_977848220

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 977848216 977848220
Species Human (GRCh38) Human (GRCh38)
Location 4:101791093-101791115 4:101791116-101791138
Sequence CCGCCAGGCAGCCCAGAGGGTTC TTCTGTCCCTGACTTCTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 230} {0: 1, 1: 0, 2: 6, 3: 31, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!