ID: 977908221_977908226

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 977908221 977908226
Species Human (GRCh38) Human (GRCh38)
Location 4:102501439-102501461 4:102501457-102501479
Sequence CCCTTCCCGTCGGTCGGGCCGCC CCGCCAGCCGCCGCAGCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 25} {0: 1, 1: 0, 2: 3, 3: 29, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!