ID: 977913764_977913773

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 977913764 977913773
Species Human (GRCh38) Human (GRCh38)
Location 4:102567049-102567071 4:102567071-102567093
Sequence CCACCTGCATGCCCACAGCCTGG GTGGGAAAACACTGTGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 56, 4: 499} {0: 1, 1: 0, 2: 0, 3: 21, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!