ID: 977951931_977951938

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 977951931 977951938
Species Human (GRCh38) Human (GRCh38)
Location 4:102981011-102981033 4:102981064-102981086
Sequence CCTCTCAATTCCTGACAACCACT CTGTTAGAATGTCATATAGTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 27, 3: 128, 4: 613} {0: 1, 1: 0, 2: 12, 3: 134, 4: 724}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!