ID: 978061394_978061401

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 978061394 978061401
Species Human (GRCh38) Human (GRCh38)
Location 4:104344730-104344752 4:104344744-104344766
Sequence CCAGCCCCCTGCCACCGTGGCTC CCGTGGCTCTCTCTAGATTTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 32, 3: 108, 4: 596} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!