ID: 978072626_978072637

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 978072626 978072637
Species Human (GRCh38) Human (GRCh38)
Location 4:104491565-104491587 4:104491610-104491632
Sequence CCGCGGCGGCGGCGGCGCTGCTG GCGCGATCTTGGCCGCCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 58, 4: 470} {0: 1, 1: 0, 2: 0, 3: 3, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!