ID: 978163879_978163886

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 978163879 978163886
Species Human (GRCh38) Human (GRCh38)
Location 4:105583380-105583402 4:105583413-105583435
Sequence CCCCAGCGTCCTCCTACCTGGCC CTGCTTCCTGTTCCTTAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 369} {0: 1, 1: 0, 2: 1, 3: 34, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!