ID: 978174904_978174913

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 978174904 978174913
Species Human (GRCh38) Human (GRCh38)
Location 4:105718208-105718230 4:105718240-105718262
Sequence CCTCCAAATTTCATGTTGAAATG ATGTTGTTGGAGGTGGGACCTGG
Strand - +
Off-target summary {0: 52, 1: 933, 2: 1801, 3: 2670, 4: 3410} {0: 1, 1: 0, 2: 5, 3: 112, 4: 837}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!