ID: 978180035_978180037

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 978180035 978180037
Species Human (GRCh38) Human (GRCh38)
Location 4:105782673-105782695 4:105782695-105782717
Sequence CCTGGGTTCAAACGATTCTCATG GCCTCAGGTCCCCTAGTAGCTGG
Strand - +
Off-target summary {0: 83, 1: 3830, 2: 57947, 3: 166820, 4: 226724} {0: 1, 1: 14, 2: 772, 3: 19674, 4: 221899}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!