|
Left Crispr |
Right Crispr |
Crispr ID |
978184176 |
978184188 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:105837395-105837417
|
4:105837443-105837465
|
Sequence |
CCTTTTTCTTCCCATGGAAACCG |
CCATGTGGCCCTTCATCACATGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 0, 2: 6, 3: 46, 4: 250} |
{0: 1, 1: 0, 2: 0, 3: 21, 4: 224} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|