ID: 978186173_978186176

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 978186173 978186176
Species Human (GRCh38) Human (GRCh38)
Location 4:105858890-105858912 4:105858925-105858947
Sequence CCAGAACCACACTCACTCAATTA ATTAAATTTTTACATCCAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 253} {0: 1, 1: 0, 2: 3, 3: 30, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!