ID: 978211486_978211487

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 978211486 978211487
Species Human (GRCh38) Human (GRCh38)
Location 4:106142772-106142794 4:106142792-106142814
Sequence CCATCACTCTTCATGAAGAAAAT AATATATTCTATAGACTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 393} {0: 1, 1: 0, 2: 2, 3: 29, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!