ID: 978286156_978286158

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 978286156 978286158
Species Human (GRCh38) Human (GRCh38)
Location 4:107079509-107079531 4:107079549-107079571
Sequence CCACATTCCTTCTGTTTATTCAA ACCTATCAAAGAACTTTTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 474} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!