ID: 978328874_978328883

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 978328874 978328883
Species Human (GRCh38) Human (GRCh38)
Location 4:107590013-107590035 4:107590052-107590074
Sequence CCTTACCTTCTTATTCTTATGTA GGAGAAAAGCTTAATTGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 368} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!