ID: 978334774_978334779

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 978334774 978334779
Species Human (GRCh38) Human (GRCh38)
Location 4:107654727-107654749 4:107654767-107654789
Sequence CCCACTGTCTGGCACAGCGCTCC AAACTCTGGATTGCGAAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 229} {0: 1, 1: 0, 2: 0, 3: 26, 4: 508}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!