ID: 978343633_978343640

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 978343633 978343640
Species Human (GRCh38) Human (GRCh38)
Location 4:107742659-107742681 4:107742685-107742707
Sequence CCAACATGAAGAAACCCCCTCTC AAAATATGCAAAAATTGGCTGGG
Strand - +
Off-target summary {0: 11, 1: 745, 2: 21376, 3: 113440, 4: 157016} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!