ID: 978343634_978343644

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 978343634 978343644
Species Human (GRCh38) Human (GRCh38)
Location 4:107742673-107742695 4:107742721-107742743
Sequence CCCCCTCTCTACAAAATATGCAA ACCTGTAGTCCCAGCTACTCGGG
Strand - +
Off-target summary No data {0: 27977, 1: 146191, 2: 244935, 3: 217028, 4: 128877}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!