ID: 978343634_978343646

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 978343634 978343646
Species Human (GRCh38) Human (GRCh38)
Location 4:107742673-107742695 4:107742724-107742746
Sequence CCCCCTCTCTACAAAATATGCAA TGTAGTCCCAGCTACTCGGGAGG
Strand - +
Off-target summary No data {0: 54131, 1: 174214, 2: 265888, 3: 193370, 4: 113909}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!