ID: 978343636_978343642

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 978343636 978343642
Species Human (GRCh38) Human (GRCh38)
Location 4:107742675-107742697 4:107742693-107742715
Sequence CCCTCTCTACAAAATATGCAAAA CAAAAATTGGCTGGGCGTGGTGG
Strand - +
Off-target summary {0: 9, 1: 599, 2: 14616, 3: 223566, 4: 146275} {0: 237, 1: 18097, 2: 82197, 3: 154951, 4: 213879}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!